-
Precious coral Corallium japonicum RAD-seq project
The aim of this study was to examine genetic population structure of a precious coral species, Corallium japonicum (the Japanese red coral) in the north-west Pacific for its... -
Genome-wide SNPs data revealed significant spatial genetic structure in deep ...
Spatial autocorrelation analysis is one useful method for estimating the spatial range of gamete and larval dispersal for corals. However, there are few studies and no attempt... -
Deep-sea coral partial genome project
We selected a deep-sea coral species Corallium japonicum as a candidate for connectivity analysis and sequenced the genome of one specimen using a Nextera XT DNA Sample Prep Kit... -
Corallium japonicum Raw sequence reads
This project contains 12 samples of RNA-seq data. The following adapter sequences may remain. Remove them as necessary. Forward: AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA Reverse:...