42 datasets found

Physiological and microbial mechanisms to mitigate Cd and Pb stress in tobacco by organic and inorganic silicon fertilizers

Sequencing of several clinical isolates of different species

CDC’s Division of Healthcare Quality Promotion’s BioProject for whole genome sequence data of Enterococcus spp. We have implemented a standard scheme for isolate/sample...

Challenges in cultivating microorganisms have limited the phylogenetic diversity of currently available microbial genomes. This is being addressed by advances in sequencing...

We have deciphered the complete genome sequence of a chromosome and two plasmids in lactobacterium, Enterococcus faecium QU 50. This strain is an efficient L-lactate producing...

Genome sequencing and assembly of E. faecium isolates from different sources (human, animal, environment)

This is a large scale project with the sequencing co-funded by collaborators at the University of Cape Town and WT Core (I2818). This is a project aimed at deepening our...

The Two Weeks in the World research project has resulted in a dataset of 3100 clinically relevant bacterial genomes with pertaining metadata, collected from 59 diagnostic units...

Veterinary Pathogens sequenced as part of the effort to Combat Antibiotic Resistant Bacteria

CRISPR-Cas9 nucleases are abundant in microbes. To explore this largely uncharacterized diversity, we applied cell-free biochemical screens to rapidly assess the protospacer...

Whole genome sequencing of bacterial isolates over a 1-year period from a hospital's intensive care units.

The fever of patients after allogeneic hematopoietic stem cell transplantation (allo-HSCT) is complex, and it is still challenging to identify the cause of the fever. The immune...

Use selective bacterial culture to understand the identity, prevalence, persistence, and transmission of bacteria contaminating hospital intensive care unit surfaces in two...

Culturable bacterial community associated with marine sponge Aplysina

The use of NGS-based testing of the bacterial microbiota is often impeded by inconsistent or non-reproducible results, especially when applying different analysis pipelines and...

We determined the first complete nucleotide sequence and analysis conjugal plasmid pEF-D, an Enterococcus faecium JH5687 plasmid encoding VanD1-type D-Alanine-D-Lactate ligase.

Genomic DNA of isolates were extracted and 16S rDNA genes were amplified with universal primers (27F: 5’ AGAG-TTTGATCCTGGCTCAG 3’ 1492R: 5’ AAGGAGGTGATCCAGCCGCA 3’).

Complete genome sequences of organisms are the foundation of understanding biological functions. High-throughput parallel sequencing technologies such as Illumina make the...

Enterococcus faecium WGS