-
Recovery of nearly 8,000 uncultivated bacterial and archaeal genomes substant...
Challenges in cultivating microorganisms have limited the phylogenetic diversity of currently available microbial genomes. This is being addressed by advances in sequencing... -
The mouse intestinal bacterial collection (miBC) represents a unique resource...
The important role of mice as a model in research of microbe host interactions increased the need for determining the limits of such experiments due to host specificity and... -
Drakenstein12internal
This is a large scale project with the sequencing co-funded by collaborators at the University of Cape Town and WT Core (I2818). This is a project aimed at deepening our... -
Two weeks in the World 2020
The Two Weeks in the World research project has resulted in a dataset of 3100 clinically relevant bacterial genomes with pertaining metadata, collected from 59 diagnostic units... -
MetaPDOcheese 4: Whole genome of bacterial isolates from cheeses and milks
The genomic dataset consists of 373 bacterial strains spanning 3 phyla (172 Actinomycetota, 6 Bacillota and 195 Pseudomonadota), 17 genera and 47 species, isolated from French... -
Bacterial isolates from intensive care units
Whole genome sequencing of bacterial isolates over a 1-year period from a hospital's intensive care units. -
Tracking_the_dynamics_of_AMR_genes_within_enteric_bacterial_communities_in_pi...
The aim of the proposed research is to define the nature and frequency of transfer of antimicrobial resistance (AMR) genes between pathogenic and commensal bacteria within their... -
Generation_of_draft_genomes_for_supershedder_and_bacteriotherapy_bacteria
http://www.sanger.ac.uk/resources/downloads/bacteria/ This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the... -
16S rDNA Sanger sequencing of LAB isolates
Genomic DNA of isolates were extracted and 16S rDNA genes were amplified with universal primers (27F: 5’ AGAG-TTTGATCCTGGCTCAG 3’ 1492R: 5’ AAGGAGGTGATCCAGCCGCA 3’). -
SC PHL pathogens isolated from wastewater samples that are not routine Genome...
Whole genome sequencing of wastewater isolates that do not fall into GenomeTrakr enteric or ESKAPE organisms. -
Pathogenic microorganism Genome sequencing
Genome sequencing of bacteria from State collection of pathogenic microorganisms Obolensk. Collection includes bacteria, fungi, and cell-lines. -
FDA-ARGOS is a database with public quality-controlled reference genomes for ...
<b>FDA-ARGOS project update</b> <p>FDA-ARGOS database updates may help researchers rapidly validate diagnostic tests and use qualified genetic sequences to...