-
CDC HAI-Seq Enterococcus species
CDC’s Division of Healthcare Quality Promotion’s BioProject for whole genome sequence data of Enterococcus spp. We have implemented a standard scheme for isolate/sample... -
16S rDNA Sanger sequencing of LAB isolates
Genomic DNA of isolates were extracted and 16S rDNA genes were amplified with universal primers (27F: 5’ AGAG-TTTGATCCTGGCTCAG 3’ 1492R: 5’ AAGGAGGTGATCCAGCCGCA 3’). -
Whole genome sequencing of bacteria from infant formula
For infants with weakened immune systems, formula milk and complementary foods are the primary sources of nutrition. However, the presence of various potential pathogenic... -
Pathogenic microorganism Genome sequencing
Genome sequencing of bacteria from State collection of pathogenic microorganisms Obolensk. Collection includes bacteria, fungi, and cell-lines. -
Bacterial isolates from Natural Cat Food Diets
WGS of bacterial isolates from Natural Cat Food Diets -
A StrainAtlas of the human gut microbiome
A cultured isolate collection from a broad human population -
Genomic_and_bacterial_blueprint_of_the_human_gastrointestinal_microbiota
Here we present a comprehensive collection of 737 whole-genome sequenced bacterial isolates from humans to understand the blueprint of human gastrointestinal microbiota. This...
