17 datasets found

Veterinary Pathogens sequenced as part of the effort to Combat Antibiotic Resistant Bacteria

The use of NGS-based testing of the bacterial microbiota is often impeded by inconsistent or non-reproducible results, especially when applying different analysis pipelines and...

There is evidence that nonalcoholic fatty liver disease (NAFLD) is affected by gut microbiota, glucose,and lipid.However,the function of water-electrolyte metabolism remains...

Genomic DNA of isolates were extracted and 16S rDNA genes were amplified with universal primers (27F: 5’ AGAG-TTTGATCCTGGCTCAG 3’ 1492R: 5’ AAGGAGGTGATCCAGCCGCA 3’).

<b>FDA-ARGOS project update</b> <p>FDA-ARGOS database updates may help researchers rapidly validate diagnostic tests and use qualified genetic sequences to...

Challenges in cultivating microorganisms have limited the phylogenetic diversity of currently available microbial genomes. This is being addressed by advances in sequencing...

These mutation accumulation lines were used in addressing mechanisms of G/C composition evolution.

the aim of this study was to clarify the effect of different silver nanoparticules (AgNP) concentrations over the time on microbial communities from a german wastewater...

This is a large scale project with the sequencing co-funded by collaborators at the University of Cape Town and WT Core (I2818). This is a project aimed at deepening our...

WGS sequencing of various bacterial isolates which were collected from mouse stool and clinical human colon samples.

The genomic dataset consists of 373 bacterial strains spanning 3 phyla (172 Actinomycetota, 6 Bacillota and 195 Pseudomonadota), 17 genera and 47 species, isolated from French...

Non-alcoholic fatty liver disease (NAFLD) is one of the most common causes of chronic liver disease in children worldwide. Gut microbiota and their metabolites may influence...

Collection of 3,087 bacterial metagenome-assembled genomes (MAGs) recovered from metagenomes available from the Sequence Read Archive. These MAGs comprise part of the data set...

The object of this study is to explore the association between maternal gut microbiota and risk of congenital heart disease in offspring, as well as the possible mechanisms...

Single isolates from an undergraduate microbiology laboratory class at Marquette University (BIOL4802). In this class, students think of a question about a particular...

Cell-free expression systems enable rapid prototyping of genetic programs in vitro. However, current throughput of cell-free measurements is often limited by the use of...

Creation of a genome sequence database of live microorganisms found in dietary supplements and cultured foods to be used for strain verification and characterization.