2 datasets found

Keywords: Lactococcus plantarum

Filter Results
  • Drakenstein12internal

    This is a large scale project with the sequencing co-funded by collaborators at the University of Cape Town and WT Core (I2818). This is a project aimed at deepening our...
  • 16S rDNA Sanger sequencing of LAB isolates

    Genomic DNA of isolates were extracted and 16S rDNA genes were amplified with universal primers (27F: 5’ AGAG-TTTGATCCTGGCTCAG 3’ 1492R: 5’ AAGGAGGTGATCCAGCCGCA 3’).
You can also access this registry using the API (see API Docs).