15 datasets found

Challenges in cultivating microorganisms have limited the phylogenetic diversity of currently available microbial genomes. This is being addressed by advances in sequencing...

Blue foxes are widely farmed in China because of the value of their fur, which can also be used as experimental animal models. Now China has become one of the largest blue fox...

Evaluation of compliance in Probiotic Products sold as dietary supplements in USA and Canada

The NBRC Whole Genome Shotgun Project aims to provide "reference genomes" of NBRC culture collection strains for identifying useful genes for taxonomic classification,...

The object of this study is to explore the association between maternal gut microbiota and risk of congenital heart disease in offspring, as well as the possible mechanisms...

The use of NGS-based testing of the bacterial microbiota is often impeded by inconsistent or non-reproducible results, especially when applying different analysis pipelines and...

http://www.sanger.ac.uk/resources/downloads/bacteria/ This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the...

Genomic DNA of isolates were extracted and 16S rDNA genes were amplified with universal primers (27F: 5’ AGAG-TTTGATCCTGGCTCAG 3’ 1492R: 5’ AAGGAGGTGATCCAGCCGCA 3’).

Target of the study is intestinal bacteria isolated from domestic pigs, wild boars, domesticated Red river hogs, wild red river hogs, domesticated warthogs,wild warthogs. WGS of...

A total of 227 genomes were sequenced using Illumina HiSeq 4000, as will serve as a baseline for benchmarking various metagenomics tools. In addition, 61 other genomes used for...

We present a description of draft genomes (MAGs) in the rumen of goat kids at 1, 7, 14, 28, 42, 56, 70 and 84 days of age

Creation of a genome sequence database of live microorganisms found in dietary supplements and cultured foods to be used for strain verification and characterization.

Here we present a comprehensive collection of 737 whole-genome sequenced bacterial isolates from humans to understand the blueprint of human gastrointestinal microbiota. This...

We have developed a bladder-specific bacterial reference database consisting of 1134 genomes to aid in genomic, functional, and experimental analyses of the human bladder...

The microbiome has revealed itself as a key player in health and disease. To better understand its role, in addition to microbial diversity, it is important to understand...