-
A StrainAtlas of the human gut microbiome
A cultured isolate collection from a broad human population -
Live Microbial Ingredients Survey
Creation of a genome sequence database of live microorganisms found in dietary supplements and cultured foods to be used for strain verification and characterization. -
16S rDNA Sanger sequencing of LAB isolates
Genomic DNA of isolates were extracted and 16S rDNA genes were amplified with universal primers (27F: 5’ AGAG-TTTGATCCTGGCTCAG 3’ 1492R: 5’ AAGGAGGTGATCCAGCCGCA 3’). -
Microorganisms isolated from sludge and swine feces for deodorization Genome ...
Microorganisms isolated from sludge and swine feces for deodorization during swine manure storage -
FDA-ARGOS is a database with public quality-controlled reference genomes for ...
<b>FDA-ARGOS project update</b> <p>FDA-ARGOS database updates may help researchers rapidly validate diagnostic tests and use qualified genetic sequences to... -
ON-rep-seq
Despite the massive developments within culture-independent methods for detection and quantification of microorganisms during the last decade culture-based methods remain a...