-
(Appendix III.1) Relative abundance of benthic foraminifera in sediment core ...
Project: Integrated Baltic Sea Environmental Study (IBSEN); funded by German Ministry of Education and Research (BMBF) -
Calcareous benthic foraminiferal fauna of a spliced sequence of sediment core...
This dataset has no description
-
Benthic foraminiferal assemblages of sediment core POS287_28-1B
This dataset has no description
-
Benthic foraminiferal assemblages of sediment core POS287_26-1B
This dataset has no description
-
Benthic foraminifera census data of sediment core GeoTü SL99
The data set contains census counts of deep-sea benthic foraminifera from the Late Quaternary section of sediment core GeoTü SL99. Given are counted individuals of benthic... -
16S rDNA Sanger sequencing of LAB isolates
Genomic DNA of isolates were extracted and 16S rDNA genes were amplified with universal primers (27F: 5’ AGAG-TTTGATCCTGGCTCAG 3’ 1492R: 5’ AAGGAGGTGATCCAGCCGCA 3’). -
Benthic foraminiferal raw counts of sediment core MD99-2343
This dataset has no description
-
Benthic foraminiferal raw counts of sediment core MD95-2043
This dataset has no description
-
Foraminifers counts of IODP Hole 381-M0079A
This dataset has no description
-
Foraminifers counts of IODP Hole 381-M0078A
This dataset has no description
-
Relative abundance of live (Rose Bengal stained) benthic foraminifera of surf...
This dataset has no description
-
Live benthic foraminifera of surface sediments from the East Atlantic contine...
live = Rose Bengal stained, method after Lutze (1964) -
Live benthic foraminifera counts in the upper 6 cm surface sediments of the s...
This dataset has no description
-
Dead benthic foraminifera counts in surface sediments of the shelf and upper ...
This dataset has no description
-
Live benthic foraminifera counts in surface sediments of the shelf and upper ...
This dataset has no description
-
(Supplementary Table 1) Species abundance of benthic foraminifera (size fract...
This dataset has no description
-
Benthic foraminiferal number, diversity, and species abundance of size fracti...
This dataset has no description
-
Benthic foraminifera from the Mauritanian shelf and upper slope
Foraminiferal assemblage data was collected from the top 0-1 cm sediment layer of 30 surface samples from the Mauritanian slope and shelf. The material was sampled with a box... -
Recent surface sediment samples of living ostracoda and foraminifera, South A...
This dataset has no description
