-
RNA Atlas of Bacterial Human Pathogens Uncovers Stress Dynamics Linked to Bac...
Pathogenic bacteria encounter a variety of stressful host environments during infection. Their responses to meet these challenges protect them from deadly damages and aid in... -
Genomic_and_bacterial_blueprint_of_the_human_gastrointestinal_microbiota
Here we present a comprehensive collection of 737 whole-genome sequenced bacterial isolates from humans to understand the blueprint of human gastrointestinal microbiota. This... -
Collection of 3,087 bacterial metagenome-assembled genomes recovered from met...
Collection of 3,087 bacterial metagenome-assembled genomes (MAGs) recovered from metagenomes available from the Sequence Read Archive. These MAGs comprise part of the data set... -
Vibrio parahaemolyticus isolated from shrimp pond
Vibrio parahaemolyticus isolated from shrimp pond -
Tracking_the_dynamics_of_AMR_genes_within_enteric_bacterial_communities_in_pi...
The aim of the proposed research is to define the nature and frequency of transfer of antimicrobial resistance (AMR) genes between pathogenic and commensal bacteria within their... -
Genomic Catalog of Human Bladder Bacteria
We have developed a bladder-specific bacterial reference database consisting of 1134 genomes to aid in genomic, functional, and experimental analyses of the human bladder... -
Bacteriophage, phage-like element and intestinal VLP metagenomics
This study explores the use of metagenomics to study the induction profiles of bacteriophages, phage-like elements and intestinal virus-like particles (VLPs) from both in vitro... -
CVM NARMS Retail Seafood Isolates
Whole genome sequencing of foodborne pathogens isolated from retail seafood as part of the US Food and Drug Administration surveillance project for NARMS -
Human microbiome associated bacterial genomes
This project is designed to uncover antimicrobial drug leads from human symbionts. -
Enterococcus faecalis Genome sequencing
to study on the sequence characteristics of linezolid resistant Enterococcus faecalis. -
Crop Bioprotection in collaboration with NRRL Raw sequence reads
Genome sequencing of Bacillus isolates. -
Clinical evaluation of mNGS in unbiased pathogens diagnosis of UTIs
Advance the implementation of mNGS in pathogen diagnosis in clinics. -
Bacteria and yeast pathogens sequenced from human blood culture specimens
Bloodstream infection is a major cause of morbidity and mortality worldwide. Early pathogen detection and administration of appropriate antimicrobial therapy substantially... -
Vet-LIRN-Other-GU
Veterinary Pathogens sequenced as part of the effort to Combat Antibiotic Resistant Bacteria -
Enhanced detection system for hospital associated transmission (EDS-HAT)
Whole genome sequencing of bacterial pathogens is combined with machine learning and data mining of the electronic medical record to enhance outbreak detection in hospitals and... -
Major food bacterial pathogens in the united states and around the world, inc...
University of California at Davis 100K Pathogen Genome Project. Major bacterial pathogens in the United States and around the world, including Salmonella enterica, E. coli,... -
16S rDNA Sanger sequencing of LAB isolates
Genomic DNA of isolates were extracted and 16S rDNA genes were amplified with universal primers (27F: 5’ AGAG-TTTGATCCTGGCTCAG 3’ 1492R: 5’ AAGGAGGTGATCCAGCCGCA 3’). -
Metagenomic next-generation sequence data of Suspected Infected Pancreatic Ne...
42 blood samples and 22 peri-pancreatic specimens from 42 suspected infected pancreatic necrosis patients were collected to investigate the diagnostic performance of metagenomic... -
Clinical metagenomics and metatranscriptomics for pathogen discovery
This project aims to develop DNA and RNA sequencing as tools for pathogen discovery in a clinical setting.