Data related to "Preferential interaction of DNMT3A subunits containing the R882H cancer mutation leads to dominant changes of flanking sequence effects"

DOI

Methylation of substrate libraries Single-stranded DNA oligonucleotides used for generation of double stranded substrates with a distance of 12 base pairs between CpG sites were obtained from IDT. Second strand synthesis was conducted by a primer extension reaction using one universal primer. The obtained library of double-stranded DNA oligonucleotides was methylated by different purified heterotetramers containing DNMT3A catalytic domain and DNMT3A R882H catalytic domain subunit, boht either containing a His-tag or MBD-tag. For this it was incubated for 60 min at 37 °C in the presence of 0.8 mM S-adenosyl-L-methionine (Sigma) in reaction buffer (20 mM HEPES pH 7.5, 1 mM EDTA, 50 mM KCl, 0.05 mg/mL bovine serum albumin). DNA concentrations were 107 nM, DNMT3A concentrations were used between 0.05 and 0.1 µM. Reactions were stopped by shock freezing in liquid nitrogen, then treated with proteinase K for 2 hours at 42 °C. Afterwards DNA was digested with BsaI-HFv2 enzyme and a hairpin (pGAGAAGGGATGTGGATACACATCCCT) was ligated using T4 DNA ligase (NEB). DNA was bisulfite converted using EZ DNA Methylation-Lightning kit (ZYMO RESEARCH) according to the manufacturer protocol, purified and eluted with 10 µL ddH2O.

NGS library generation Libraries for Illumina Next Generation Sequencing (NGS) were produced with the two-step PCR approach. In the first PCR, 2 µL of bisulfite-converted DNA were amplified with the HotStartTaq DNA Polymerase (QIAGEN) and primers containing internal barcodes using following conditions: 15 min at 95 °C, 10 cycles of 30 sec at 94 °C, 30 sec at 50 °C, 1 min and 30 sec at 72 °C, and final 5 min at 72 °C; using a mixture containing 1x PCR Buffer, 1x Q-Solution, 0.2 mM dNTPs, 0.05 U/µL HotStartTaq DNA Polymerase, 0.4 µM forward and 0.4 µM reverse primers in a total volume of 20 µL. In the second PCR, 1 µL of obtained products were amplified by Phusion Polymerase (Thermo) with another set of primers to introduce adapters and indices needed for NGS (30 sec at 98 °C, 10 cycles - 10 sec at 98 °C, 40 sec at 72 °C, and 5 min at 72 °C). PCRII was carried out in 1x Phusion HF Buffer, 0.2 mM dNTPs, 0.02 U/µL Phusion HF DNA Polymerase, 0.4 µM forward and 0.4 µM reverse primers in a total volume of 20 µL. Obtained libraries were pooled in equimolar amounts, purified and sequenced in the Max Planck Genome Centre Cologne.

Bioinformatic analysis Bioinformatic analysis of obtained NGS data was conducted with a local Galaxy server and with home written scripts. Briefly, fastq files were analyzed by FastQC, 3’ ends of the reads with a quality lower than 20 were trimmed and reads containing both full-length sense and antisense strands were selected. Next, the samples were split using the internal barcodes with respect to the different experimental conditions. Afterwards the insert DNA sequence was extracted and used for further downstream analysis. The uploaded text files contain the bisulfite converted sequences with pairs of CpG sites in 12 bp distance as described in the furhter documentation (info.pdf).

The naming of the files is as follows: Name, Complex, Repeat, c(DNMT3AC) [µM] 1WW, His-WT/MBP-WT, R1, 0.1 2WW, His-WT/MBP-WT, R2, 0.05 1RR, His-R882H/MBP-R882H, R1, 0.1 2RR, His-R882H/MBP-R882H, R2, 0.07 1RW, His-R882H/MBP-WT, R1, 0.1 2RW, His-R882H/MBP-WT, R2, 0.1 1WR, His-WT/MBP-R882H, R1, 0.1 2WR, His-WT/MBP-R882H, R2, 0.1

Identifier
DOI https://doi.org/10.18419/darus-2231
Metadata Access https://darus.uni-stuttgart.de/oai?verb=GetRecord&metadataPrefix=oai_datacite&identifier=doi:10.18419/darus-2231
Provenance
Creator Jeltsch, Albert ORCID logo; Bashtrykov, Pavel ORCID logo; Adam, Sabrina ORCID logo; Mack, Alexandra; Emperle, Max
Publisher DaRUS
Contributor Jeltsch, Albert
Publication Year 2021
Funding Reference Sander Foundation 2019.058.1 ; DFG JE 252/36 - 403074082
Rights CC BY 4.0; info:eu-repo/semantics/openAccess; http://creativecommons.org/licenses/by/4.0
OpenAccess true
Contact Jeltsch, Albert (Universität Stuttgart)
Representation
Resource Type DNA sequences after hairpin ligation and bisulfite conversion; Dataset
Format application/octet-stream; application/pdf
Size 19679776; 23541790; 21273974; 46172246; 17082990; 19814446; 19774648; 18548012; 238643
Version 1.1
Discipline Basic Biological and Medical Research; Biochemistry; Biology; Chemistry; Life Sciences; Medicine; Natural Sciences